Sort by:

The Accuracy People Reviews

Showing 4 star reviews : View all 979 reviews

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Debbie U, 18 May 2023

Great course. Really helpful techniques that I will use in my own work.

Helpful review?   Yes   No

[ Inappropriate review ]

Dylan B, 18 May 2023

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Helpful review?   Yes   No

[ Inappropriate review ]

Matt L, 17 May 2023

Would've preferred something that was a bit more about mindset

Helpful review?   Yes   No

[ Inappropriate review ]

Chris M, 27 Apr 2023

The course has taught me a lot on how to reduce written errors. Some of the topics discussed I would not have even considered and it opened my eyes to how many potential errors could be made.

Helpful review?   Yes   No

[ Inappropriate review ]

Ishani S, 27 Apr 2023

Learnt about different techniques to improve written communication. The trainer was amazing as he encouraged everyone to participate and engage and constantly apply what he was teaching to examples.

Helpful review?   Yes   No

[ Inappropriate review ]

Brandon S, 13 Apr 2023

Course and content taught was good and to a high level. The lessons and mantra are clear and effective. However, the course could be condensed into one session. Seven total hours is slightly onerous.

Helpful review?   Yes   No

[ Inappropriate review ]

Debbie M, 09 Mar 2023

Found the course very good and helpful.

Helpful review?   Yes   No

[ Inappropriate review ]

Chris H, 01 Mar 2023

I liked having physical materials and the pen with a highlighter on it. The course could've had more interactivity. I thought the preview session was better than the day itself. Maybe it could've had more breakout rooms? The session felt very long despite the breaks, but it was thorough. I will use the skills you've given me.

Helpful review?   Yes   No

[ Inappropriate review ]