Showing 81–90 of 240 reviews (4 star)
Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role
Good course, very helpful tools, First day felt quite repetitive
I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.
It was a good course but very repetitive and long
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).
Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.
Great course. Really helpful techniques that I will use in my own work.
The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work
Would've preferred something that was a bit more about mindset
The course has taught me a lot on how to reduce written errors. Some of the topics discussed I would not have even considered and it opened my eyes to how many potential errors could be made.