The Accuracy People reviews

4.7 (1,062 reviews)
AI summary of reviews

Its trainers make the demanding subject of accuracy feel engaging and approachable, using humour, clear explanations and a supportive atmosphere to involve everyone. Attendees value the practical exercises, mini-assessments, group work and memorable techniques for checking data, written communication, concentration and workload. They say the learning is well structured, supported by useful materials and breaks, and readily applied to everyday work to reduce errors and improve confidence. Some find the sessions longer or more repetitive than necessary.

Engaging trainersPractical techniquesWorkplace application

Generated from recent reviews; may not reflect every review

Showing 81–90 of 240 reviews (4 star)

Sort by

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Chibesa D · 21 Jun 2023
Helpful review?YesNo
Report review

Good course, very helpful tools, First day felt quite repetitive

Jessica L · 26 May 2023
Helpful review?YesNo
Report review

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Phoebe N · 24 May 2023
Helpful review?YesNo
Report review

It was a good course but very repetitive and long

Rose C · 24 May 2023
Helpful review?YesNo
Report review

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Jakub Z · 24 May 2023
Helpful review?YesNo
Report review

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Damian K · 24 May 2023
Helpful review?YesNo
Report review

Great course. Really helpful techniques that I will use in my own work.

Debbie U · 18 May 2023
Helpful review?YesNo
Report review

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Dylan B · 18 May 2023
Helpful review?YesNo
Report review

Would've preferred something that was a bit more about mindset

Matt L · 17 May 2023
Helpful review?YesNo
Report review

The course has taught me a lot on how to reduce written errors. Some of the topics discussed I would not have even considered and it opened my eyes to how many potential errors could be made.

Chris M · 27 Apr 2023
Helpful review?YesNo
Report review