+44 (0)20 3432 4484Find a course
Sort by:

The Accuracy People Reviews

Faheem P, 24 May 2023

The course structure and content was excellent.

Helpful review?   Yes   No

[ Inappropriate review ]

Faye H, 24 May 2023

Liz brought the topics to life with her examples.

Helpful review?   Yes   No

[ Inappropriate review ]

Farhana B, 24 May 2023

I enjoyed this training, Liz was very interactive with us and super friendly.

Helpful review?   Yes   No

[ Inappropriate review ]

Sam G, 24 May 2023

Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.

Helpful review?   Yes   No

[ Inappropriate review ]

Humna A, 24 May 2023

Greg was really interactive and made the course as interesting as could be!

Helpful review?   Yes   No

[ Inappropriate review ]

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Rose C, 24 May 2023

It was a good course but very repetitive and long

Helpful review?   Yes   No

[ Inappropriate review ]

Phoebe N, 24 May 2023

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Helpful review?   Yes   No

[ Inappropriate review ]

Rebekah W, 18 May 2023

Really good training session, insightful and will help us all in the line of work we do.

Helpful review?   Yes   No

[ Inappropriate review ]