Showing 51–60 of 146 reviews (4 star)
This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique
Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role
Good course, very helpful tools, First day felt quite repetitive
It was a good course but very repetitive and long
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).
Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.
Great course. Really helpful techniques that I will use in my own work.
The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work
Would've preferred something that was a bit more about mindset