Developing an Eye for Accuracy reviews

4.7 (709 reviews)
AI summary of reviews

Attendees particularly value the practical accuracy techniques, including clustering, focused checking, regular breaks and recognising personal error patterns. They describe the sessions as interactive and engaging, with varied exercises, assessments and useful materials that reveal how easily mistakes occur. Trainers are praised for their knowledge, clarity, patience and ability to involve everyone. Attendees say the learning improves concentration and confidence and transfers directly to daily work, although some find the sessions lengthy and repetitive.

Practical techniquesInteractive exercisesEngaging trainers

Generated from recent reviews; may not reflect every review

Showing 51–60 of 146 reviews (4 star)

Sort by

The course was good.

Laura D · 27 Jun 2023
Helpful review?YesNo
Report review

This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique

Richard J · 27 Jun 2023
Helpful review?YesNo
Report review

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Chibesa D · 21 Jun 2023
Helpful review?YesNo
Report review

Good course, very helpful tools, First day felt quite repetitive

Jessica L · 26 May 2023
Helpful review?YesNo
Report review

It was a good course but very repetitive and long

Rose C · 24 May 2023
Helpful review?YesNo
Report review

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Jakub Z · 24 May 2023
Helpful review?YesNo
Report review

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Damian K · 24 May 2023
Helpful review?YesNo
Report review

Great course. Really helpful techniques that I will use in my own work.

Debbie U · 18 May 2023
Helpful review?YesNo
Report review

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Dylan B · 18 May 2023
Helpful review?YesNo
Report review

Would've preferred something that was a bit more about mindset

Matt L · 17 May 2023
Helpful review?YesNo
Report review