Developing an Eye for Accuracy reviews

4.7 (709 reviews)
AI summary of reviews

Attendees particularly value the practical accuracy techniques, including clustering, focused checking, regular breaks and recognising personal error patterns. They describe the sessions as interactive and engaging, with varied exercises, assessments and useful materials that reveal how easily mistakes occur. Trainers are praised for their knowledge, clarity, patience and ability to involve everyone. Attendees say the learning improves concentration and confidence and transfers directly to daily work, although some find the sessions lengthy and repetitive.

Practical techniquesInteractive exercisesEngaging trainers

Generated from recent reviews; may not reflect every review

Showing 391–400 of 763 reviews

Sort by

Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.

Sam G · 24 May 2023
Helpful review?YesNo
Report review

Greg was really interactive and made the course as interesting as could be!

Humna A · 24 May 2023
Helpful review?YesNo
Report review

It was a good course but very repetitive and long

Rose C · 24 May 2023
Helpful review?YesNo
Report review

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Jakub Z · 24 May 2023
Helpful review?YesNo
Report review

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Damian K · 24 May 2023
Helpful review?YesNo
Report review

Really impressed with what I have taken away and learned about myself during the course. This course has supported the nature of work we do and different ways to identify how we can work. Also Greg has a great way of relating to things we discussed so thank you Greg!

Asha K · 18 May 2023
Helpful review?YesNo
Report review

Really good training session, insightful and will help us all in the line of work we do.

Rebekah W · 18 May 2023
Helpful review?YesNo
Report review

Super fun and informative!

B O · 18 May 2023
Helpful review?YesNo
Report review

Wonderful course, and Liz was super. I've learnt a lot on how to better myself in my role.

Blue C · 18 May 2023
Helpful review?YesNo
Report review

Liz was really passionate and engaging, she made the course very interactive, was never bored and I honestly found the course very useful. Highly recommend

Bianca A · 18 May 2023
Helpful review?YesNo
Report review